Skip to main content

The potential for gene-editing to increase muscle growth in pigs: experiences with editing myostatin

Abstract

Gene-editing holds promise as a new technique for growth promotion in livestock, especially in the face of increased opposition to traditional methods of growth promotion like feed additives. However, to date, there has been only limited progress toward models of growth promotion through gene-editing. The vast majority of gene-editing projects have focused on a single gene, myostatin (MSTN), with several reports of successful editing events. These attempts have been limited by the low efficiency of successful edits and issues of viability. The use of both microinjection and somatic cell nuclear transfer appear to be susceptible to these viability issues. Herein, we report a successful editing of myostatin in pigs using a zinc-finger nuclease targeted at exon 3 of myostatin. Overall, the successful editing rate was 1% (37 edited cell lines/3616 screened cell lines). Edits included a variety of small indels and larger deletions. One male and one female cell line with a deletion of one thymidine residue (− 1 T) were selected for somatic cell nuclear transfer. Of the ~ 900 embryos transferred, there were 12 live births (1 male, 11 females) but only 5 female pigs survived to sexual maturity. These animals were bred to commercial sires to expand the population and determine potential interactive effects between myostatin mutations and the naturally-occurring g.3072G > A mutation in insulin-like growth factor 2. Even in subsequent generations (F0xWT, F1xF0, F1xF1), viability of piglets continued to be poor and was associated with the progeny’s proportion of the original clone genome, even in pigs lacking MSTN loss-of-function (LOF) mutations. However, viability of pigs with myostatin LOF (MSTN−/−) was especially poor as none of the 37 animals born were viable. Sequencing of cloned pigs indicated that off-target effects did not explain this poor viability. Reducing the percentage of the cloned genome by outcrossing successfully improved viability of MSTN+/+ and MSTN± pigs, but not of MSTN−/− pigs. Characterization of MSTN± pigs did reveal an increase in muscle growth and body weight compared with MSTN+/+ pigs. Therefore, in order for the promise of gene-editing of myostatin for growth promotion in livestock to be fulfilled, issues of viability of offspring and efficacy of editing have yet to be overcome. Additionally, gene-editing targets other than myostatin must be explored.

Background

In the next 30 years, the world population is predicted to increase to between 9.5 and 10 billion people, resulting in an increased demand for food. In particular, the demand for animal-derived protein is expected to increase 50–100%. While alternative proteins like those from plant-based meat substitutes or derived from cultured cells may help in meeting this demand, a large part of this demand will need to be met by improved production efficiencies. This need for increased production efficiencies and reduced environmental impact is especially important because land availability for agriculture will be in flux due to climate change and population growth (Zhang and Cai 2011).

In the past, increased production efficiencies have been achieved through genetic selection, improved diet formulation and management practices, and by using growth promoting feed additives and technologies. However, consumer resistance, especially towards growth-promoting technologies, is threatening their continued use in many scenarios. Additionally, consumer scrutiny regarding animal housing practices has increased. Giving up these technologies and techniques will threaten the ability of animal agriculture to continue making gains in production efficiencies and sustainability. Therefore, new methods to increase efficiency are needed. To date, only a limited number of genetically engineered animals have been approved for human consumption and commercial availability remains very restricted. However, this technology has the potential to replace other growth promoting technologies and speed improvements in animal efficiency.

Myostatin as a target for gene editing in pigs

Myostatin (MSTN) is a powerful regulator of muscle growth, primarily affecting prenatal muscle cell hyperplasia (McPherron et al. 1997). Myostatin increases p21 expression and reduces Cdk2 activity leading to cell cycle arrest and regulation of the number of myoblasts present to form muscle. Myostatin also inhibits myoblast differentiation, decreasing myoblast fusion into myotubes. Naturally occurring loss-of-function (LOF) mutants in cattle exhibit generalized increases in muscle growth and improved feed conversion (Arthur 1995; Grobet et al. 1998). In fact, LOF mutations in MSTN cause “double-muscling” in several species including cattle, sheep, mice, humans, and dogs (Grobet et al. 1998; Mosher et al. 2007; McPherron and Lee 1997; Schuelke et al. 2004; Kambadur et al. 1997; Clop et al. 2006). In contrast, myostatin LOF variants in pigs have not been reported although several putative regulatory variants have been associated with MSTN gene expression, growth rate, and lean meat yield (Stinckens et al. 2008; Yu et al. 2007; Liu et al. 2011; Tu et al. 2014). Because commercial pig breeding populations are under intense selection for lean yield, the failure to detect spontaneous MSTN LOF mutations in pigs that increase muscularity is surprising.

Given the significant impact MSTN polymorphism has on growth and development, and the paucity of other genes that have effects of similar magnitude, MSTN has become the primary focus for gene editing efforts aimed at improving lean growth efficiency within livestock species (Table 1, end of document). All three gene editing technologies, zinc-finger nucleases (ZFNs), transcription activator-like effector nuclease (TALENs), and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated protein (Cas) 9 (CRISPR/Cas9) system (Miller et al. 2007, 2011; Wood et al. 2011; Carlson et al. 2012; Le et al. 2013) have been applied to editing of MSTN with limited success. Cattle have been targeted the least, presumably due to the high number of existing LOF variants already present in many breeds dispersed throughout the world (Grobet et al. 1998). In addition, due to the persistent inefficiencies associated with gene editing, the long gestation length and typical singleton births in cattle can make the production of live edited animals very costly. Although naturally occurring mutations exist in sheep and goats, the primary aim of editing MSTN has been directed at the improvement of breeds previously not selected intensely for meat production. The pig has been the most popular target for editing, likely due to the lack of naturally occurring LOF variants within the species.

Table 1 Gene editing to improve lean growth and efficiency in livestock species

Currently, there are two primary approaches for implementing gene editing methods to produce live animals. These are somatic cell nuclear transfer (SCNT), and microinjection (MI) of zygotes derived from natural mating or in vitro fertilization (MI-IVF). The primary advantage of SCNT is the potential to select for specific modifications prior to generating embryos, thus significantly improving the proportion of animals carrying a specific mutation(s). However, SCNT has also been associated with the occurrence of early pregnancy loss and congenital abnormalities that can significantly decrease the number of viable individuals produced. Alternatively, MI is typically associated with fewer congenital defects, but efficacy is directly reliant on the targeting efficiency of the gene editing method being used. Furthermore, MI is associated with the potential to generate mosaicism or multiple editing events within individual offspring, which could be viewed positively as it could potentially provide more allelic variation from which to choose.

The application of gene editing platforms has certainly evolved over the past decade. However, even as proficiencies have increased, particularly with the accessibility of tools like CRISPR/Cas9, success has been limited (Table 1). To date, among the four attempts targeting MSTN in cattle, only seven live edited calves have been reported (Ge et al. 2021; Luo et al. 2014; Gim et al. 2021; Proudfoot et al. 2015). All three editing platforms were used with similar targeting efficiencies. As would be expected from SCNT, approximately 8% of the embryos transplanted resulted in live born calves with all matching the biallelic edits of the donor cells (Luo et al. 2014). In contrast, the MI-IVF embryos yielded more pregnancies and live calves yet produced similar numbers of edited progeny due to targeting efficiency and direct transfer of embryos with no opportunity for selection (Gim et al. 2021; Proudfoot et al. 2015). Both studies using MI-IVF, calves had a high degree of mosaicism or multiple alleles. All edited calves displayed increased muscularity similar to existing naturally occurring LOF MSTN alleles. In contrast to the hyperplasia generally associated with MSTN LOF, hypertrophy was reported as the mechanism underlying increased muscularity (Luo et al. 2014). In sheep, the production of live, edited offspring is higher (n = 33) (Proudfoot et al. 2015; Zhang et al. 2019; Crispo et al. 2015; Wang et al. 2016a; Ding et al. 2020; Han et al. 2014), although the number of embryos produced for transfer is many times higher than in cattle, still indicating a relatively low yield. The litter bearing nature of sheep allows the transfer of multiple embryos to recipient females potentially leading to increased pregnancies, and subsequently the opportunity to observe more edited progeny. Most reports have been based on CRISPR/Cas9 and MI where the yield of edited offspring ranged from 6% (2 of 35) to 45% (10 of 22). Multiple alleles within individuals and mosaicism were also reported in more than half of these studies (Wang et al. 2016a; Ding et al. 2020; Han et al. 2014). The detailed phenotypic characterization of MSTN-edited sheep is limited but the general characteristics of increased growth rate and muscling are reported (Crispo et al. 2015; Wang et al. 2016a; Ding et al. 2020). Similar to edited cattle, two studies have reported muscle fiber hypertrophy as the basis of the increased muscularity (Zhang et al. 2019; Wang et al. 2016a). Of the six reported outcomes in goats, three efforts used SCNT resulting in four live offspring, two of which were heterozygous (Ni et al. 2014; Zhang et al. 2018; Yu et al. 2016). MI was used in the remainder of the reports resulting in 22 edited animals (Guo et al. 2016; He et al. 2018; Wang et al. 2015a). This again suggests that although almost 100% of animals derived from SCNT will be modified, MI, either using natural embryos or IVF, may be a more efficient approach for producing edited animals where the species is amenable to the production and transfer of many single cell embryos. As in sheep, the detailed phenotypic characterization of edited animals is lacking, but increased growth and muscularity are also described (Zhang et al. 2018; He et al. 2018). The underlying basis of the increased muscle development was reported as hypertrophy in two studies (Zhang et al. 2018; Yu et al. 2016) and both hyperplasia and hypertrophy in a third (He et al. 2018). There is a single report of MSTN editing in rabbits using CRISPR/Cas9 and MI (Guo et al. 2016). Although the targeting efficiency was relatively high, yielding 24 biallelic edited offspring out of 34 live born kittens, 14 succumbed to large tongue syndrome, a condition more often associated with SCNT (Kurome et al. 2013). In addition, a high degree of mosaicism and multiple alleles was also present. Knockout of MSTN resulted in a significant increase in birth weight [~ 20%) and weights of the quadricep and bicep muscles of 50% and 98%, respectively.

There have been nearly twice the number of attempts to edit MSTN in pigs as there have been in any other livestock species. Although all three editing platforms have been used, only SCNT has been implemented for the generation of live animals (Bi et al. 2016; Li et al. 2020; Rao et al. 2016; Qian et al. 2015; Wang et al. 2015b, 2016b, 2017; Zou et al. 2019; Kang et al. 2014, 2017). As indicated previously, the primary impetus for targeting of MSTN is due to the lack of naturally occurring LOF mutations within the species although four of the current attempts were performed in Chinese indigenous breeds to rapidly increase lean yield (Bi et al. 2016; Li et al. 2020; Qian et al. 2015; Wang et al. 2017). The use of SCNT is best suited to the pig where large numbers of reconstructed embryos can be transferred to a single female, thus increasing the probability of successful pregnancies. Somewhat unexpectedly, the results have been highly variable although perhaps not due to the same issues as in the other livestock species. The earliest attempt did not specify either the editing or reproduction method (Kang et al. 2014), yet successfully produced live piglets with both monoallelic and biallelic editing events. Interestingly, all biallelic offspring died < 10 days after birth, while monoallelic-edited piglets were viable. Two additional efforts observed the same viability phenomenon between genotypes (Rao et al. 2016; Wang et al. 2015b). In contrast, three attempts generated modest numbers of biallelic edited piglets that were viable and raised to harvest age or adulthood (Qian et al. 2015; Wang et al. 2017; Kang et al. 2017). Notably, two of the three studies that reported high viability of biallelic edited animals were conducted in Chinese breeds where the IGF2 g.3072G > A polymorphism is not segregating (Qian et al. 2015; Wang et al. 2017). This suggests the combination of MSTN LOF and the IGF2 g.3072A allele may influence viability. However, the third study was conducted using modern commercial germplasm were IGF2 g.3072A is assumed to be present (Kang et al. 2017). Three other studies only produced monoallelic edited progeny at very low efficiency having only one or two offspring generated from hundreds of reconstructed embryos (Bi et al. 2016; Wang et al. 2016b; Zou et al. 2019). Most recently, Li et al. (2020) reported the production of 16 liveborn piglets, however only three were edited, one monoallelic and two biallelic. Unfortunately, of the three edited alleles identified, two allowed production of mature myostatin protein although at reduced rates (Li et al. 2020). Phenotypic analyses of both monoallelic and biallelic edited animals shows the tremendous potential of MSTN LOF mutations with significant increases in lean muscle and reduction of adiposity for both genotypes (Ni et al. 2014; Rao et al. 2016; Qian et al. 2015; Kang et al. 2017). More consistent with the known function of MSTN, most reports defined the underlying mechanism of increased muscularity to be from hyperplasia (Bi et al. 2016; Li et al. 2020; Rao et al. 2016; Qian et al. 2015; Wang et al. 2015b) rather than hypertrophy (Kang et al. 2014, 2017).

Two additional genes have also been targeted in pigs, F-box protein 40 (FBXO40) and insulin-like growth factor 2 (IGF2) (Zou et al. 2018; Xiang et al. 2018) (Table 1). Both reports demonstrated modest success generating 20 live edited offspring between them. One of these introduced LOF mutations in the FBXO40 gene based on prior observations in mice (Shi et al. 2011). The knockout of FXBO40 resulted in muscular hypertrophy that significantly increased lean yield with no apparent negative effects on animal health (Zou et al. 2018). The targeting of IGF2 was aimed at mimicking the previously identified g.3072G > A mutation within the ZBED6 repressor binding site in intron 3 of the gene (Laere et al. 2003). The IGF2 editing was performed in the miniature Chinese Bama breed, which only has the ancestral IGF2 g.3072G allele. Successful editing generated increases in IGF2 expression and subsequently significant differences in growth rate between edited and wild type pigs (Xiang et al. 2018). These differences are consistent with the impact of this mutation in the vast majority of commercial germplasm used in modern pork production.

Impact of IGF2 on lean muscle growth in pigs

Both insulin-like growth factor 1 (IGF1) and IGF2 are key regulators of myogenesis. Specifically, IGF2 promotes differentiation of myoblasts in both cell culture (Florini et al. 1991) and somatic (Pirskanen et al. 2000) from chicks. The expression of IGF2 is elevated during embryonic and fetal development but is down-regulated after birth (Rotwein et al. 1987), which is different from the expression of IGF1 that remains relatively high postnatally (Clark et al. 2014; Beck et al. 1987; Bondy et al. 1990). In swine, IGF2 is of particular interest as a quantitative trait locus (QTL) controlling muscle growth and fat deposition. The quantitative trait nucleotide (QTN) has been identified as a single base pair substitution in intron 3 of IGF2 (g.3072G > A). The substitution alters a conserved CpG island that is hypomethylated in skeletal muscle and has been identified as a binding site for the transcriptional repressor, zinc-finger BED-containing 6 (ZBED6) (Laere et al. 2003; Markljung et al. 2009). This mutation results in a fourfold increase in IGF2 expression in postnatal muscle (Laere et al. 2003), and a tendency to increase late prenatal IGF2 expression (Clark et al. 2015 May 1), resulting in increased muscle hyperplasia and muscle weight. Most of the germplasm used for commercial pork production has this IGF2 mutation due to the intensive selection for lean growth. The g.3072A allele increases lean meat yield through increased muscle accretion and reduced subcutaneous adipose tissue deposition (Jeon et al. 1999; Nezer et al. 1999).

If the mechanism by which increased postnatal IGF2 expression increases lean meat yield overlaps with that of LOF MSTN mutations, it is possible that the near fixation of the IGF2 g.3072A allele in commercial pigs may mask the appearance of naturally-occurring myostatin mutants, thus precluding them from selection. Alternatively, potential epistasis between such alleles may produce phenotypes that are less desirable, or potentially even subject to negative selection pressure. We have partially characterized the mechanism by which the IGF2 mutation results in increased muscle accretion (Clark et al. 2014; Clark et al. 2015 May 1). IGF2 is imprinted resulting in expression of only the paternal allele (DeChiara et al. 1991). As such, experimental animals were generated by mating heterozygous A/G boars to A/A sows. As expected, IGF2 expression was increased in longissimus muscle of Apat (i.e., inheriting the paternally expressed A allele) pigs compared with Gpat pigs beginning at birth and continuing to market age (176 d, 127 kg). Surprisingly, despite the increase in IGF2 expression of approximately fourfold at market age, there was no increase in muscle fiber cross-sectional area in Apat pigs. However, there was a tendency for IGF2 expression to also be increased at d90 of gestation, and expression of IGF1 receptor was increased in Apat pigs at d60 of gestation. This increase in receptor expression and the tendency for increased IGF2 expression prenatally likely contributed to the 11% increase in muscle fiber number of Apat pigs (Clark et al. 2015). Therefore, we concluded that the increase in muscle weight of Apat pigs at market age was solely from muscle fiber hyperplasia, suggesting increased prenatal muscle fiber formation (Clark et al. 2015). In mice, we have demonstrated that the complete lack of functional myostatin increased IGF2 expression in muscles but did not alter IGF1 expression (Clark et al. 2015). However, in IGF2 Apat pigs, myostatin expression was unaltered compared with Gpat pigs (Clark et al. 2015). This suggests that while MSTN LOF mutations may exert some growth-promoting effects through the IGF2 signaling pathway, IGF2 does not reciprocally regulate MSTN.

Generation of MSTN edited pigs

Given this potential overlap of mechanisms between increased muscling from increased IGF2 and myostatin LOF, we considered IGF2 status when generating myostatin LOF mutations in pigs. Two commercial crossbred sows homozygous for the IGF2 g.3072A allele (A/A) were artificially inseminated with semen from a heterozygous (A/G) purebred Berkshire boar. Pregnancies were terminated at day 60 of gestation and 25 fetuses were harvested and used to create fetal fibroblast cell lines. Each fetus was genotyped for the IGF2 QTN and only those cell lines with an A/G genotype were used for editing. One male and one female cell line were selected for nucleofection with a ZFN (Sigma) targeted at exon 3 of the porcine MSTN gene. Approximately 2 × 106 cells were nucleofected (Nucleofector™, Amaxa) with 5 ug of ZFN mRNA and 2 ug of pmaxGFP vector using program U-023. Alternatively, for homology directed repair (HDR), 0.1 nmol of synthetic single-stranded oligo (5’-TTCACACAGAATCCCTTTTTAGAAGTCAAGGTAACAGACACACCAAAAAGATCTAGATGAGATTTGGTCTTGACTGTGATGAGCACTCAACAGAATCTCGATGCTGTCGTTACCCTCTAA-3’) was added to the nucleofection reaction. Following nucleofection, cells were recovered for five days and were sorted by positive fluorescence using a BD FACS Aria III flow cytometer. Approximately four cells were sorted into each well of multiple 96-well tissue culture plates and cultured for 14 days with media replacement every three days. Surviving sublines were consolidated into 96-well plates and a sample taken for DNA isolation. PCR was performed to amplify the region flanking the ZFN target site. Amplicons were sequenced directly to determine potential editing events. Amplicons of edited sublines were subcloned into plasmid vectors and 96 plasmids were sequenced for each cell line to determine clonal status and define alleles in biallelic edited cell lines. From 3,616 cell lines screened, 37 edited lines were identified (Table 2) with various mutations (Table 3).

Table 2 Summary of editing rate
Table 3 Summary of editing events

One male and one female cell line containing a deletion of one thymidine residue (− 1 T) were selected as donor cells for SCNT. SCNT was performed by Trans Ova Genetics (Sioux Center, IA). Single-cell embryos were shipped to the University of Illinois and approximately 150 reconstructed embryos were surgically transferred to pre-synchronized gilts.

From the male cell line, four SCNT/embryo transfers (ET) were conducted with only one producing a pregnancy that resulted in three piglets; two were stillborn and a third piglet died within 24 h of birth. All three piglets displayed congenital abnormalities common in SCNT, including growth retardation and oversize tongues (Kurome et al. 2013). Evidence suggests that epigenetic changes may be one cause of these various phenotypic abnormalities (Shi et al. 2003). Cloned swine have differential methylation patterns in the imprinted genes H19, IGF2R, INS, and IGF2 (Shen et al. 2012; Jiang et al. 2007 Mar 26; Kang et al. 2001 Oct 26) that may result from incomplete reprogramming of somatic cells during the SCNT process. Therefore, we attempted to produce a viable gene-edited male individual via the “recloning” of the live born male piglet by generation of a new fibroblast cell line following its death. Following SCNT, two ET using this new cell line resulted in a single pregnancy that produced two stillborn piglets with the same abnormal phenotypes. This suggests that specific cell lines and their derivatives may be permanently refractory to SCNT. Furthermore, this phenomenon may be due to improper epigenetic reprogramming of somatic cells that is stable throughout many mitotic divisions.

The transfers using the female cell line resulted in a 100% pregnancy rate producing 14 piglets. Of these piglets, three were stillborn with similar defects to the male line and three more died or were euthanized within 24 h of birth. One of these piglets was alive and healthy but was laid on by the sow. Genomic DNA was isolated from one viable female piglet and one abnormal stillborn female littermate to examine methylation patterns of the H19, IGF2R, INS, and IGF2 genes. Three individual sites located in the INS and IGF2_differentially methylated region 2 (DMR2) products exhibited significant differences between the two samples (P < 0.01). The entire amplified product of IGF2_DMR2 contained 33 CpG sites and was also shown to have significant differences when all sites were considered jointly (Fig. 1). Although only two animals were analyzed, this suggests that the epigenetic variation of these regions may have some causal effect on the resulting abnormal phenotypes, thus leading to the reduced viability. Three more piglets were euthanized before breeding due to various complications (unthrifty, injured, and unable to conceive). A summary of SCNT results is presented in Table 4.

Fig. 1
figure 1

Lollipop diagram of CpG sites in the IGF2 DMR2 product. Each circle represents 1 of 33 CpG sites. Filled circles represent methylated sites and open circles represent unmethylated sites. The position of each site in the product is indicated at the top

Table 4 Summary of SCNT success

Viability of gene edited piglets is related to the percentage of clone genome and genotype

The five-remaining edited, female clones (F0) were mated to several commercially available Berkshire boars that were heterozygous for the IGF2 g.3072 mutation (A/G) with the goal of expanding the breeding population and eventually producing myostatin knockout (MKO) pigs. These initial matings (wild type (WT) x F0) produced F1 piglets that were subsequently bred to both WT and F1 individuals. The WT individuals included randomly selected commercial gilts in the case of F1 x WT matings, and unrelated Berkshire boars that were heterozygous at the IGF2 locus in WT X F1 matings. In both mating types, the segregation ratios were consistent with Mendelian inheritance producing roughly a 1:1 ratio of homozygous (MSTN+/+) and heterozygous (MSTN±) offspring (Table 5). Following these matings, the F1 individuals were mated to other heterozygous animals including both F1 and F0 pigs. Matings were designed to limit inbreeding as much as possible given the limitations of the population structure (i.e., all animals carrying the edited MSTN allele had the same founder clones in the pedigree). Segregation was also consistent with Mendelian ratios for both MSTN (Table 5) and IGF2 (data not shown). Although the edited MSTN allele segregated appropriately, and without any evidence of an interaction between paternal IGF2 allele, two characteristics readily emerged from these matings. Firstly, the viability of pigs in several of these mating types was extremely low (Table 5). Secondly, all homozygous edited piglets (MSTN−/−) were non-viable with approximately 25% being stillborn and the remainder dying or requiring euthanasia within 72 h of birth (Tables 5 and 6). MSTN−/− piglets were typically smaller than their littermates at birth and those born alive appeared to be weak and unthrifty (data not shown).

Table 5 Survival of offspring by generational mating type
Table 6 Survival of offspring by parental genotype

Whole genome sequencing of the primary cell line and a single live clone (approximately 35X genome coverage each) revealed no evidence of deleterious off-target modifications although 4911 variants were detected between the two genomes using the most conservative variant calling pipeline (data not shown). Of these high-quality variant calls, only four were identified in coding regions, all of which were benign. Thus, we feel it is unlikely the reduced viability is due to deleterious mutations caused by off-target editing events. The differences between the genomes of the primary cell line and live clone are most likely the result of somatic mosaicism accumulated during cell culture or during development. Although the accumulation of these mutations could have an effect on the viability of the cells or the cloned animals (Youssoufian and Pyeritz 2002), it would be difficult to demonstrate.

Instead, we suggest there is a relationship between F0 genome proportion and viability (Table 5, Fig. 2). Furthermore, the underlying basis of this relationship can potentially be explained by genome-wide epigenetic variation that is stably inherited from the F0 ancestor, a potential example of transgenerational epigenetic inheritance. However, F0 genome proportion and its hypothesized epigenetic variation alone does not account for the reduced viability of F1 × F1 piglets compared to WT × F0 piglets. Although piglets derived from these matings would be expected to have similar genomic contributions from the F0 individuals (i.e., 50%), viability is reduced in F1 × F1 matings due to the production of MSTN−/− progeny in these matings. If overall viability was only associated with changes in genome-wide epigenetic variation, it would be expected that these losses would be randomly distributed among myostatin genotypes (Table 6).

Fig. 2
figure 2

Viability of Gene-edited Piglets based on Percentage of Clone Genome. The percentage of clone genome was assigned to offspring by averaging the contribution of each parent. For example, mating of a cloned female (100% clone genome) with a commercial male (0% clone genome) resulted in offspring that were 50% clone genome. When those offspring were mated to a cloned female, the resulting progeny were 75% clone genome. Bars represent means ± standard errors. Bars with different superscripts are different (P < 0.05)

There are two potential explanations for this interaction between proportion of F0 genome contribution and myostatin genotype. Firstly, heritable epigenetic changes produced during SCNT specifically may affect gene networks involved in growth and development, and these networks require functional myostatin. Epigenetic regulation (i.e., methylation) allows for programming of gene expression by the environment. The classic example of this epigenetic programming is in response to maternal nutrient deficiencies where gene expression of the fetus is programmed to adapt to a nutrient-scarce environment (Funston et al. 2010; Du et al. 2010). Changes in metabolism, growth and efficiency then tend to conserve nutrients. Cell culture, where edited fetal fibroblast cells used for SCNT and embryo transfer were held for several weeks, can also alter methylation patterns in cells, and these changes are heritable (Nilsson et al. 2005; Choi et al. 2012). Cells dividing in culture are provided with an optimal environment in terms of nutrients, temperature, and space. Thus, cells may have responded to this environment with epigenetic changes that adapted their “offspring” to survive in a nutrient-rich environment. For example, global demethylation of genes regulating growth would increase their expression and allow cells to proliferate rapidly. When those cells then underwent SCNT, epigenetic marks appear to be maintained in cloned (F0) pigs and inherited in future (F1) generations. In general, myostatin inhibits cell proliferation. Therefore, myostatin in piglets with inherited epigenetic marks to accelerate proliferation (increased F0 genome) may aid in holding accelerated proliferation in check; this allows for some viable MSTN+/+ and MSTN± piglets to be produced. Without myostatin, however, piglets epigenetically programmed for rapid proliferation during development are not viable.

Secondly, the mechanism may involve heritable genetic or epigenetic variation that has been selected for due to the presence of the IGF2 g.3072A allele, though not result directly from the interaction of the IGF2 and myostatin alleles. With the near fixation of the IGF2 g.3072A allele in commercial swine, it can be hypothesized that other genetic polymorphism or stable epigenetic modifications have been selected for and incorporated in the “context” of IGF2 g.3072A, thus changing the genetic architechure of muscle development to be incompatible with MSTN LOF. Such polymorphisms or epigenetic modifications would not be genetically linked to IGF2 and therefore, would not be detected as an epistatic interaction between IGF2 and myostatin genotypes. This mechanism may be supported by results of other groups that have also successfully edited myostatin in pigs where MKO offspring have also been 100% non-viable using commercial germplasm (Rao et al. 2016; Wang et al. 2015b; Kang et al. 2014). In contrast, MKO piglets derived from both Meishan and Erhualian germplasm are viable (Qian et al. 2015; Wang et al. 2017) These germplasms differ significantly in IGF2 g.3072A allele frequency and selection pressure for lean growth. Interestingly, one study has reported biallelic editing in improved germplasm, but the allele frequencies of the IGF2 g.3072 locus were not disclosed (Kang et al. 2017).

We have tentatively shown that developmentally important genes such as IGF2 have distinctly different epigenetic profiles in viable and non-viable piglets (Fig. 2), which is regulated by myostatin. Epigenetic changes in growth-regulating genes like IGF2 receptor have been noted to reduce viability in cattle (Chen et al. 2015). Thus, we hypothesize that the aberrant epigenetic variation that leads to the observed non-viability of MKO piglets will map to specific gene networks where myostatin is essential for proper development.

Characterization of pigs with one edited myostatin allele

Despite the viability issues of MKO piglets, we were able to successfully characterize the phenotype of pigs carrying one edited allele. In total, 44 pigs were slaughtered at the University of Illinois Meat Science Laboratory. These pigs represented 4 experimental genotypes: 1) wild-type MSTN (MSTN+/+) with IGF2 Gpat (n = 13); 2) MSTN+/+ with IGF2 Apat (n = 11); 3) one edited MSTN allele (MSTN±) with IGF2 Gpat (n = 10); and 4) MSTN± with IGF2 Apat (n = 10). Both barrows and gilts were represented in each genotype. Pigs were approximately 175d of age at the time of slaughter. Carcass characteristics and muscle weights were collected from these animals and the effects of sex, myostatin genotype, IGF2 genotype and their interactions were analyzed with the PROC MIXED procedure of SAS.

Though ending live weights were not different between MSTN± pigs and MSTN+/+ pigs, dressing percentage was greater in MSTN± pigs compared to MSTN+/+ pigs. In previous cattle studies, it is suggested that organ weights are decreased in double muscled cattle (Fiems 2012), which would lead to increased dressing percentages. Loin muscle area, an indication of whole-body muscle deposition, was increased by approximately 20% in MSTN± pigs compared with MSTN+/+. Additionally, the interaction of IGF2 and myostatin genotype tended to be significant for loin muscle area (P = 0.09]. Loin muscle area increased 14% in MSTN± Apat pigs compared to MSTN+/+ Apat pigs, but increased 28% in MSTN± Gpat pigs compared to MSTN+/+ Gpat pigs (Table 7).

Table 7 Carcass characteristics of myostatin heterozygous and wild type pigs

Individual muscle weights (Table 8) including the longissimus dorsi, psoas major, and semitendinosus were also increased in MSTN± pigs compared with MSTN+/+ pigs by 7–21%. When expressed as a percentage of chilled side weight, these increases were maintained and the percentage of chilled side weight as triceps brachii weight was also increased in MSTN± compared with MSTN+/+ pigs.

Table 8 Muscle weights of myostatin heterozygous and wild type pigs

These data suggest that while the complete loss of myostatin function may be lethal in much of commercial pig germplasm, a partial loss increased muscle deposition similar to observations in other species. Though we previously reported that myostatin expression was not altered in IGF2 Apat pigs compared with Gpat pigs (Clark et al. 2014), the increase in loin muscle area was doubled in MSTN± Gpat pigs compared with MSTN± Apat pigs suggesting that the pathways by which IGF2 and the loss of myostatin increase loin muscle deposition may overlap.

Conclusions

To date, there has been limited success generating viable gene-edited animals for growth promotion. This lack of success may be attributed to several reasons, all which warrant future research and improvement. First, only a limited scope of targets have been edited. The vast majority of reported edits have been for MSTN. Therefore, additional targets need to be identified. Second, efficacy of generating successful edits remains low, though there continue to be improvements in techniques to improve targeting efficiency. For example, the CRISPR/Cas9 system holds great promise for targeting efficiency. Third, there appears to be significant issues with both the use of SCNT and MI for the production of viable offspring. We have demonstrated substantial challenges in piglet viability following SCNT that appear unrelated to the viability issues related to MSTN genotype in pigs. Overcoming the issue of low viability after gene-editing may prove to be the most difficult task. Therefore, while gene-editing holds great promise to accelerate growth-promotion in livestock in the future, several technical challenges must be overcome before its true potential can be reached.

Availability of data and materials

The datasets used and/or analyzed and during the current study are available from the corresponding author on request.

Abbreviations

DMR:

Differentially methylated region

ET:

Embryo transfer

FBXO40:

F-Box protein 40

IGF1 :

Insulin-like growth factor 1

IGF2 :

Insulin-like growth factor 2

LOF:

Loss of function

MI:

Microinjection

MI-IVF:

Microinjection during in vitro fertilization

MSTN :

Myostatin

MKO:

Myostatin knock-out

QTL:

Quantitative trait loci

QTN:

Quantitative trait nucleotide

SCNT:

Somatic cell nuclear transfer

WT:

Wild type

References

  • Arthur PF. Double muscling in cattle: a review. Aust J Agric Res. 1995;46(8):1493–515.

    Article  Google Scholar 

  • Beck F, Samani NJ, Penschow JD, Thorley B, Tregear GW, Coghlan JP. Histochemical localization of IGF-I and -II mRNA in the developing rat embryo. Development. 1987;101(1):175–84.

    CAS  PubMed  Article  Google Scholar 

  • Bi Y, Hua Z, Liu X, Hua W, Ren H, Xiao H, et al. Isozygous and selectable marker-free MSTN knockout cloned pigs generated by the combined use of CRISPR/Cas9 and Cre/LoxP. Sci Rep. 2016;6(1):31729.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • Bondy CA, Werner H, Roberts CT Jr, LeRoith D. Cellular pattern of insulin-like growth factor-I (IGF-I) and Type I igf receptor gene expression in early organogenesis: comparison with IGF-II gene expression. Mol Endocrinol. 1990;4(9):1386–98.

    CAS  PubMed  Article  Google Scholar 

  • Carlson D, Tan W, Lillico S, Stverakova D, Proudfoot C, Christian M, et al. Efficient TALEN-mediated gene knockout in livestock. Proc Natl Acad Sci. 2012;109(43):17382–7.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • Chen Z, Hagen D, Elsik C, Ji T, Morris C, Moon L, et al. Characterization of global loss of imprinting in fetal overgrowth syndrome induced by assisted reproduction. Proc Natl Acad Sci. 2015;112(15):4618–23.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • Choi MR, In YH, Park J, Park T, Jung KH, Chai JC, et al. Genome-scale DNA methylation pattern profiling of human bone marrow mesenchymal stem cells in long-term culture. Exp Mol Med. 2012;44(8):503–12.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • Clark DL, Bohrer BM, Tavárez MA, Boler DD, Beever JE, Dilger AC. Effects of the porcine IGF2 intron 3–G3072A mutation on carcass cutability, meat quality, and bacon processing1. J Anim Sci. 2014;92(12):5778–88.

    CAS  PubMed  Article  Google Scholar 

  • Clark DL, Clark DI, Hogan EK, Kroscher KA, Dilger AC. Elevated insulin-like growth factor 2 expression may contribute to the hypermuscular phenotype of myostatin null mice. Growth Horm IGF Res. 2015;25(5):207–18.

    CAS  PubMed  Article  Google Scholar 

  • Clark DL, Clark DI, Beever JE, Dilger AC. Increased prenatal IGF2 expression due to the porcine IGF2 intron3-G3072A mutation may be responsible for increased muscle mass1. J Anim Sci. 2015;93(5):2546–58.

    CAS  PubMed  Article  Google Scholar 

  • Clop A, Marcq F, Takeda H, Pirottin D, Tordoir X, Bibé B, et al. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nat Genet. 2006;38(7):813–8.

    CAS  PubMed  Article  Google Scholar 

  • Crispo M, Mulet AP, Tesson L, Barrera N, Cuadro F, dos Santos-Neto PC, et al. Efficient generation of myostatin knock-out sheep using CRISPR/Cas9 technology and microinjection into zygotes. PLoS ONE. 2015;10(8): e0136690.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • DeChiara TM, Robertson EJ, Efstratiadis A. Parental imprinting of the mouse insulin-like growth factor II gene. Cell. 1991;64(4):849–59.

    CAS  PubMed  Article  Google Scholar 

  • Ding Y, Zhou S, Ding Q, Cai B, Zhao X, Zhong S, et al. The CRISPR/Cas9 induces large genomic fragment deletions of MSTN and phenotypic changes in sheep. J Integr Agric. 2020;19(4):1065–73.

    CAS  Article  Google Scholar 

  • Du M, Tong J, Zhao J, Underwood KR, Zhu M, Ford SP, et al. Fetal programming of skeletal muscle development in ruminant animals1. J Anim Sci. 2010;88(suppl_13):E51-60.

    CAS  PubMed  Article  Google Scholar 

  • Fiems LO. Double muscling in cattle: genes, husbandry, carcasses and meat. Animals. 2012;2:472–506.

    PubMed  PubMed Central  Article  Google Scholar 

  • Florini JR, Magri KA, Ewton DZ, James PL, Grindstaff K, Rotwein PS. “Spontaneous” differentiation of skeletal myoblasts is dependent upon autocrine secretion of insulin-like growth factor-II. J Biol Chem. 1991;266(24):15917–23.

    CAS  PubMed  Article  Google Scholar 

  • Funston RN, Larson DM, Vonnahme KA. Effects of maternal nutrition on conceptus growth and offspring performance: implications for beef cattle production1. J Anim Sci. 2010;88(suppl_13):E205–15.

    CAS  PubMed  Article  Google Scholar 

  • Ge L, Kang J, Dong X, Luan D, Su G, Li G, et al. Myostatin site-directed mutation and simultaneous PPARγ site-directed knockin in bovine genome. J Cell Physiol. 2021;236(4):2592–605.

    CAS  PubMed  Article  Google Scholar 

  • Gim GM, Kwon DH, Eom KH, Moon JH, Park JH, Lee WW, et al. Production of MSTN-mutated cattle without exogenous gene integration using CRISPR-Cas9. Biotechnol J. 2021. https://doi.org/10.1002/biot.202100198.

    Article  PubMed  Google Scholar 

  • Grobet L, Poncelet D, Royo LJ, Brouwers B, Pirottin D, Michaux C, et al. Molecular definition of an allelic series of mutations disrupting the myostatin function and causing double-muscling in cattle. Mamm Genome. 1998;9(3):210–3.

    CAS  PubMed  Article  Google Scholar 

  • Guo R, Wan Y, Xu D, Cui L, Deng M, Zhang G, et al. Generation and evaluation of Myostatin knock-out rabbits and goats using CRISPR/Cas9 system. Sci Rep. 2016;6(1):29855.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • Han H, Ma Y, Wang T, Lian L, Tian X, Hu R, et al. One-step generation of myostatin gene knockout sheep via the CRISPR/Cas9 system. Front Agric Sci Eng. 2014;1(1):2–5.

    Article  Google Scholar 

  • He Z, Zhang T, Jiang L, Zhou M, Wu D, Mei J, et al. Use of CRISPR/Cas9 technology efficiently targetted goat myostatin through zygotes microinjection resulting in double-muscled phenotype in goats. Biosci Rep. 2018;38(6): BSR20180742.

    PubMed  PubMed Central  Article  Google Scholar 

  • Jeon J-T, Carlborg Ö, Törnsten A, Giuffra E, Amarger V, Chardon P, et al. A paternally expressed QTL affecting skeletal and cardiac muscle mass in pigs maps to the IGF2 locus. Nat Genet. 1999;21(2):157–8.

    CAS  PubMed  Article  Google Scholar 

  • Jiang L, Jobst P, Lai L, Samuel M, Ayares D, Prather RS, et al. Expression levels of growth-regulating imprinted genes in cloned piglets. Cloning Stem Cells. 2007;9(1):97–106.

    CAS  PubMed  Article  Google Scholar 

  • Kambadur R, Sharma M, Smith TPL, Bass JJ. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese Cattle. Genome Res. 1997;7(9):910–5.

    CAS  PubMed  Article  Google Scholar 

  • Kang Y-K, Koo D-B, Park JS, Choi Y-H, Kim H-N, Chang W-K, et al. Typical demethylation events in cloned pig embryos: clues on species-specific differences in epigenetic reprogramming of a cloned donor genome *. J Biol Chem. 2001;276(43):39980–4.

    CAS  PubMed  Article  Google Scholar 

  • Kang JD, Kim S, Zhu HY, Jin L, Guo Q, Li XC, et al. Generation of cloned adult muscular pigs with myostatin gene mutation by genetic engineering. RSC Adv. 2017;7(21):12541–9.

    CAS  Article  Google Scholar 

  • Kang Q, Hu Y, Zou Y, Hu W, Li L, Chang F, et al. Improving pig genetic resistance and muscle production through molecular biology. In Proceedings, 10th World Congress of Genetics Applied to Livestock Production. 2014. pp. 17–22.

  • Kurome M, Geistlinger L, Kessler B, Zakhartchenko V, Klymiuk N, Wuensch A, et al. Factors influencing the efficiency of generating genetically engineered pigs by nuclear transfer: multi-factorial analysis of a large data set. BMC Biotechnol. 2013;13(1):43.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • Le C, Ann RF, David C, Shuailiang L, Robert B, Naomi H, et al. Multiplex genome engineering using CRISPR/Cas systems. Science (80-). 2013;339(6121):819–23.

    Article  CAS  Google Scholar 

  • Li R, Zeng W, Ma M, Wei Z, Liu H, Liu X, et al. Precise editing of myostatin signal peptide by CRISPR/Cas9 increases the muscle mass of Liang Guang Small Spotted pigs. Transgenic Res. 2020;29(1):149–63.

    CAS  PubMed  Article  Google Scholar 

  • Liu D, Xu Q, Zang L, Liang S, Wu Y, Wei S, et al. Identification and genetic effect of haplotypes in the promoter region of porcine myostatin gene. Anim Genet. 2011;42(1):6–14.

    PubMed  Article  CAS  Google Scholar 

  • Luo J, Song Z, Yu S, Cui D, Wang B, Ding F, et al. Efficient generation of myostatin (MSTN) biallelic mutations in cattle using zinc finger nucleases. PLoS ONE. 2014;9(4): e95225.

    PubMed  PubMed Central  Article  CAS  Google Scholar 

  • Markljung E, Jiang L, Jaffe JD, Mikkelsen TS, Wallerman O, Larhammar M, et al. ZBED6, a novel transcription factor derived from a domesticated DNA transposon regulates IGF2 expression and muscle growth. PLOS Biol. 2009;7(12): e1000256.

    PubMed  PubMed Central  Article  CAS  Google Scholar 

  • McPherron AC, Lee S-J. Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci. 1997;94(23):12457–61.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • McPherron AC, Lawler AM, Lee S-J. Regulation of skeletal muscle mass in mice by a new TGF-p superfamily member. Nature. 1997;387(6628):83–90.

    CAS  PubMed  Article  Google Scholar 

  • Miller JC, Holmes MC, Wang J, Guschin DY, Lee Y-L, Rupniewski I, et al. An improved zinc-finger nuclease architecture for highly specific genome editing. Nat Biotechnol. 2007;25(7):778–85.

    CAS  PubMed  Article  Google Scholar 

  • Miller JC, Tan S, Qiao G, Barlow KA, Wang J, Xia DF, et al. A TALE nuclease architecture for efficient genome editing. Nat Biotechnol. 2011;29(2):143–8.

    CAS  PubMed  Article  Google Scholar 

  • Mosher DS, Quignon P, Bustamante CD, Sutter NB, Mellersh CS, Parker HG, et al. A mutation in the myostatin gene increases muscle mass and enhances racing performance in heterozygote dogs. PLOS Genet. 2007;3(5): e79.

    PubMed  PubMed Central  Article  CAS  Google Scholar 

  • Nezer C, Moreau L, Brouwers B, Coppieters W, Detilleux J, Hanset R, et al. An imprinted QTL with a major effect on muscle mass and fat deposition maps to the IGF2 locus in pig. Nat Genet. 1999;21:155–6.

    CAS  PubMed  Article  Google Scholar 

  • Ni W, Qiao J, Hu S, Zhao X, Regouski M, Yang M, et al. Efficient gene knockout in goats using CRISPR/Cas9 system. PLoS ONE. 2014;9(9): e106718.

    PubMed  PubMed Central  Article  CAS  Google Scholar 

  • Nilsson O, Mitchum RD, Schrier L, Ferns SP, Barnes KM, Troendle JF, et al. Growth plate senescence is associated with loss of DNA methylation. J Endocrinol. 2005;186(1):241–9.

    CAS  PubMed  Article  Google Scholar 

  • Pirskanen A, Kiefer JC, Hauschka SD. IGFs, insulin, Shh, bFGF, and TGF-β1 interact synergistically to promote somite myogenesis in vitro. Dev Biol. 2000;224(2):189–203.

    CAS  PubMed  Article  Google Scholar 

  • Proudfoot C, Carlson DF, Huddart R, Long CR, Pryor JH, King TJ, et al. Genome edited sheep and cattle. Transgenic Res. 2015;24(1):147–53.

    CAS  PubMed  Article  Google Scholar 

  • Qian L, Tang M, Yang J, Wang Q, Cai C, Jiang S, et al. Targeted mutations in myostatin by zinc-finger nucleases result in double-muscled phenotype in Meishan pigs. Sci Rep. 2015;5(1):14435.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • Rao S, Fujimura T, Matsunari H, Sakuma T, Nakano K, Watanabe M, et al. Efficient modification of the myostatin gene in porcine somatic cells and generation of knockout piglets. Mol Reprod Dev. 2016;83(1):61–70.

    CAS  PubMed  Article  Google Scholar 

  • Rotwein P, Pollock KM, Watson M, Milbrandt JD. Insulin-like growth factor gene expression during rat embryonic development*. Endocrinology. 1987;121(6):2141–4.

    CAS  PubMed  Article  Google Scholar 

  • Schuelke M, Wagner KR, Stolz LE, Hübner C, Riebel T, Kömen W, et al. Myostatin mutation associated with gross muscle hypertrophy in a child. N Engl J Med. 2004;350(26):2682–8.

    CAS  PubMed  Article  Google Scholar 

  • Shen C, Cheng W, Wu S, Chen H, Tsai T, Yang S, et al. Differential differences in methylation status of putative imprinted genes among cloned swine genomes. PLoS ONE. 2012;7(2): e32812.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • Shi W, Zakhartchenko V, Wolf E. Epigenetic reprogramming in mammalian nuclear transfer. Differentiation. 2003;71(2):91–113.

    CAS  PubMed  Article  Google Scholar 

  • Shi J, Luo L, Eash J, Ibebunjo C, Glass DJ. The SCF-Fbxo40 complex induces IRS1 ubiquitination in skeletal muscle, limiting IGF1 signaling. Dev Cell. 2011;21(5):835–47.

    PubMed  Article  CAS  Google Scholar 

  • Stinckens A, Luyten T, Bijttebier J, Van den Maagdenberg K, Dieltiens D, Janssens S, et al. Characterization of the complete porcine MSTN gene and expression levels in pig breeds differing in muscularity. Anim Genet. 2008;39(6):586–96.

    CAS  PubMed  Article  Google Scholar 

  • Tu PA, Lo LL, Chen YC, Hsu CC, Shiau JW, Lin EC, et al. Polymorphisms in the promoter region of myostatin gene are associated with carcass traits in pigs. J Anim Breed Genet. 2014;131(2):116–22.

    CAS  PubMed  Article  Google Scholar 

  • Van Laere A-S, Nguyen M, Braunschweig M, Nezer C, Collette C, Moreau L, et al. A regulatory mutation in IGF2 causes a major QTL effect on muscle growth in the pig. Nature. 2003;425(6960):832–6.

    PubMed  Article  CAS  Google Scholar 

  • Wang X, Yu H, Lei A, Zhou J, Zeng W, Zhu H, et al. Generation of gene-modified goats targeting MSTN and FGF5 via zygote injection of CRISPR/Cas9 system. Sci Rep. 2015a;5(1):13878.

    PubMed  PubMed Central  Article  Google Scholar 

  • Wang K, Ouyang H, Xie Z, Yao C, Guo N, Li M, et al. Efficient generation of myostatin mutations in pigs using the CRISPR/Cas9 system. Sci Rep. 2015b;5(1):16623.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • Wang X, Niu Y, Zhou J, Yu H, Kou Q, Lei A, et al. Multiplex gene editing via CRISPR/Cas9 exhibits desirable muscle hypertrophy without detectable off-target effects in sheep. Sci Rep. 2016a;6(1):32271.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • Wang K, Tang X, Liu Y, Xie Z, Zou X, Li M, et al. Efficient generation of orthologous point mutations in pigs via CRISPR-assisted ssODN-mediated homology-directed repair. Mol Ther Nucleic Acids. 2016b;5: e396.

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  • Wang K, Tang X, Xie Z, Zou X, Li M, Yuan H, et al. CRISPR/Cas9-mediated knockout of myostatin in Chinese indigenous Erhualian pigs. Transgenic Res. 2017;26(6):799–805.

    CAS  PubMed  Article  Google Scholar 

  • Wood A, Lo T, Zeitler B, Pickle C, Ralston E, Lee A, et al. Targeted genome editing across species using ZFNs and TALENs. Science (80-). 2011;333(6040):307.

    CAS  Article  Google Scholar 

  • Xiang G, Ren J, Hai T, Fu R, Yu D, Wang J, et al. Editing porcine IGF2 regulatory element improved meat production in Chinese Bama pigs. Cell Mol Life Sci. 2018;75(24):4619–28.

    CAS  PubMed  Article  Google Scholar 

  • Youssoufian H, Pyeritz RE. Mechanisms and consequences of somatic mosaicism in humans. Nat Rev Genet. 2002;3(10):748–58.

    CAS  PubMed  Article  Google Scholar 

  • Yu L, Tang H, Wang J, Wu Y, Zou L, Jiang Y, et al. Polymorphisms in the 5′ regulatory region of myostatin gene are associated with early growth traits in Yorkshire pigs. Sci China Ser C Life Sci. 2007;50(5):642–7.

    CAS  Article  Google Scholar 

  • Yu B, Lu R, Yuan Y, Zhang T, Song S, Qi Z, et al. Efficient TALEN-mediated myostatin gene editing in goats. BMC Dev Biol. 2016;16(1):26.

    PubMed  PubMed Central  Article  CAS  Google Scholar 

  • Zhang X, Cai X. Climate change impacts on global agricultural land availability. Environ Res Lett. 2011;6(1):14014.

    Article  Google Scholar 

  • Zhang J, Cui ML, Nie YW, Dai B, Li FR, Liu DJ, et al. CRISPR/Cas9-mediated specific integration of fat-1 at the goat MSTN locus. FEBS J. 2018;285(15):2828–39.

    CAS  PubMed  Article  Google Scholar 

  • Zhang Y, Wang Y, Yulin B, Tang B, Wang M, Zhang C, et al. CRISPR/Cas9-mediated sheep MSTN gene knockout and promote sSMSCs differentiation. J Cell Biochem. 2019;120(2):1794–806.

    CAS  Article  Google Scholar 

  • Zou Y, Li Z, Zou Y, Hao H, Li N, Li Q. An FBXO40 knockout generated by CRISPR/Cas9 causes muscle hypertrophy in pigs without detectable pathological effects. Biochem Biophys Res Commun. 2018;498(4):940–5.

    CAS  PubMed  Article  Google Scholar 

  • Zou Y, Li Z, Zou Y, Hao H, Hu J, Li N, et al. Generation of pigs with a Belgian Blue mutation in MSTN using CRISPR/Cpf1-assisted ssODN-mediated homologous recombination. J Integr Agric. 2019;18(6):1329–36.

    CAS  Article  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This work was supported by grant 2012–67015-19438 from the USDA National Institute of Food and Agriculture. Funding was also received from the University of Illinois Campus Research Board.

Author information

Authors and Affiliations

Authors

Contributions

LH, BM, and XC collected and analyzed the data. AD and JE wrote the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to A. C. Dilger.

Ethics declarations

Ethics approval and consent to participate

Approval for animal use was obtained from the University of Illinois Institutional Animal Care and Use committee (protocols 13332, 17021, 19262).

Consent for publication

All authors have consented to this submission.

Competing interests

The funders listed above had no role in the composition or writing of the manuscript, or in the decision to publish.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Dilger, A.C., Chen, X., Honegger, L.T. et al. The potential for gene-editing to increase muscle growth in pigs: experiences with editing myostatin. CABI Agric Biosci 3, 36 (2022). https://doi.org/10.1186/s43170-022-00106-6

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s43170-022-00106-6

Keywords

  • Gene-editing
  • Growth
  • Livestock
  • Myostatin
  • Muscle
  • Pig
  • Zinc-finger nuclease